Scatter Hitam Turun Kayak BadaiWild Ajaib Mahjong WaysPecahan Naga Emas Bawa Duit8 Juta Dalam Sekali Putaran

Advances in Animal and Veterinary Sciences

Download PDF Download ePUB
AAVS_9_8_1223-1232

 

 

Research Article

 

Relationship between Phenotypic and Genotypic Antimicrobial Resistance of Escherichia coli Isolates from Mastitic Milk

 

Samah El-sayed M, Soliman M Soliman*, Adel Abdel-Azim Fayed, Samia Abd El-hamid Ahmed

Department of Medicine and Infectious Diseases, Faculty of Veterinary Medicine, Cairo University, Egypt.

 

Abstract | Bovine mastitis is the predominant problem in dairy farms worldwide which caused mainly by Escherichia coli (E. coli) as one of the main causes of what is called “environmental mastitis”. A total of 68 E. coli isolates from 205 raw milk samples of Holstein cows with mastitis in different dairy farms from different governorates by bacteriological isolation and 63 by PCR were investigated for the E. coli 16S rRNA and rfbEO157 encoding gene as Shiga toxin-producing E. coli (STEC). The occurrence of E. coli O157 in mastitic cows was 3% within E. coli isolates. Molecular investigation of extended-spectrum β-lactamases (ESBLs) and plasmid-mediated AmpC β-lactamases (PABLs) encoding genes reported in all of the isolates (100%) encoded TEM-type ESBLs, none of which (0%) encoded OXA-type ESBLs, on the other hand, CTX-M-type ESBLs and SHV-type β-lactamases were encoded in 34/63 (53.9%) and 3/63 (4.7%) of the ESBL isolates, respectively and 27% exhibited CMYІІ-type PABLs. Plasmid-mediated colistin resistance encoding gene (mcr-1) was expressed in 1.6% of E. coli isolates. All E. coli isolates exhibited antibiotic multi-resistances with higher resistance to tetracycline and Trimethoprim-Sulfamethoxazole (45.7% and 37.3%, respectively), while the lowest resistance was observed for Amoxicillin/clavulanate (10.1%). Phenotypic resistance to extended-spectrum cephalosporins (ESCs) revealed that 42.3% of these strains were resistant to (cefotaxime and cefquinome), 15% resistant to Cefoxitin, while 32.2% were resistant to ceftazidime. Conclusively, E. coli was found to be the major cause of bovine mastitis treatment failure due to the multidrug resistance to most newly developed cephalosporins (third and fourth generations).

 

Keywords | Bovine mastitis, Milk, Antimicrobial Resistance, ESBLs, PABLs and mcr-1.

 

Received | March 30, 2021; Accepted | April 10, 2021; Published | July 01, 2021

*Correspondence | Soliman M Soliman, Department of Medicine and Infectious Diseases, Faculty of Veterinary Medicine, Cairo University, Egypt; Email: soliman450@yahoo.com

Citation | M El-Sayed S, Soliman SM, Fayed AAA, Ahmed SAH (2021). Relationship between phenotypic and genotypic antimicrobial resistance of escherichia coli isolates from mastitic milk. Adv. Anim. Vet. Sci. 9(8): 1223-1232.

DOI | http://dx.doi.org/10.17582/journal.aavs/2021/9.8.1223.1232

ISSN (Online) | 2307-8316; ISSN (Print) | 2309-3331

Copyright © 2021 Soliman et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

 

INTRoDUCTION

 

Mastitis is a major concern for dairy producers causing significant economic losses for the dairy industry. The most frequently isolated causative agent related to bovine intramammary infection is Escherichia coli (E. coli) (Keane et al., 2013; Olde et al., 2008; Bradley et al., 2007), Because E. coli is a widespread environmental pathogen, can invade the udder. The decrease in the incidence of clinical mastitis has a positive impact on animal health, animal welfare, antimicrobial usage, work pleasure, and net farm return (Trevisi et al., 2014). Herd management factors, such as milking technique and hygiene standards, were associated with variations in distributions of a mastitis-causing pathogen in the herd (Barkema et al., 1999; Dufour et al., 2011; Piepers et al., 2011; Levison et al., 2016).

 

Clinical mastitis can be caused mainly by coliform infections (De Vliegher et al., 2012). A wide range of systemic disease severity, from mild to severe with systemic signs including dehydration, shock, and even death (Wenz et al., 2001). As well as zoonotic public health impact on human especially Shiga-toxigenic E. coli (STEC) strains including O157 causing bovine mastitis (Lin et al., 2011).

 

Many problems facing the dairy industry requires antimicrobial therapy, Mastitis is one of them (Grave et al., 1999). Which is usually employed in treating/preventing mastitis, such as β-lactams, sulphonamides, quinolones, macrolides and tetracyclines (Bengtsson et al., 2009; Mathew et al., 2007; McEwen and Fedorka-Cray, 2002).

 

The misuse of antibiotics caused drug resistance and treatment failures in many cases, especially for multidrug-resistant bacteria (Suojala et al., 2013; Sweeney et al., 2018). Carattoli (2008) has announced the antimicrobial resistant E. coli strains increase within animals and claimed these animals to be a reservoir of such strains for humans and the environment. Potential transmission of resistant E. coli within animals and humans can occur through various pathways, as the food chain (Poirel et al., 2018).

 

Extended-spectrum β-lactamases (ESBLs) producing E. coli, which shows resistance to penicillins, aminopenicillins, and cephalosporins, including the third (ceftiofur) and fourth (cefquinome) generations, has been commonly isolated from food-producing animals with global veterinary and public health issues (Seiffert et al., 2013; Poirel et al., 2018). ESBLs that inactivates ESCs were graded as class A (TEM, SHV and CTXM) and class D (OXA) β-lactamases, While plasmid AmpC β-lactamases (PABLs) belonged to class C (CMYII) confer resistance to a wide variety of β-lactams, primarily 7-a-methoxy-cephalosporins (Cephamycins) such as cefoxitin (Livermore and Woodford, 2006; Jacoby, 2009). Antibiotics used for humans and animals are closely related, abuse of these drugs resulted in the development of multidrug-resistant bacteria (Cantas et al., 2013; Walther et al., 2017). So, for efficient control and treatment of mastitis; the causative agents of IMI in dairy herds need to be well-identified. Antimicrobial susceptibility determined in vitro has been considered as a pre-requisite for treatment. However, in vitro activity does not guarantee in vivo effectiveness in bovine mastitis treatment (Pyörälä, 2009).

 

Colistin, a member of polymyxins (polymyxin E), is the main drug for E. coli (Kempf et al., 2013; Poirel et al., 2017). But, Colistin resistance was identified due to the emergence of highly transmissible plasmid-mediated colistin-resistant (mcr-1) gene in E. coli strains obtained from animals, food, and patients from China (Liu et al., 2016). This resistance has created global issues due to the high transmission rate of the mcr-1 gene to epidemic strains of Enterobacteriaceae and thus hinders the effectiveness of colistin in humans (Rebelo et al., 2018).

 

The objectives of this study were to identify the impact of multidrug resistance development of E. coli strains isolated from mastitic dairy cow’s milk, evaluate phenotypic antibiotic resistance profile of isolated strains and their association to genotypic antimicrobial resistance to provide efficient treatment.

 

MATERIALS AND METHODS

 

Sample Collection

205 pooled milk samples were collected using the California mastitis test (CMT) from 205 mastitic dairy cows from five dairy farms located in Fayoum, Ismailia, El-sharkia, Alexandria and Giza governorates between November 2019 and October 2020. Milk samples (approximately 15 ml) were aseptically drawn from each cow immediately according to the National Mastitis Council, 1990 then samples were transferred to the laboratory for further examination.

 

Phenotypic Identification

Milk samples were cultured in Eosin Methylene Blue agar media (EMB) (Oxoid). Agar plates were incubated at 37ºC, and the bacterial growth was evaluated after 24 and 48 hrs. Using phenotypic differentiation of bacterial species presumptively based on colony morphology and Gram’s staining (David, 2011).

 

Genotypic Identification

The genomic DNA of all E. coli strains was extracted (Kang et al., 2004) and stored at -20°C for detection of genes encoding for 16srRNA, rfbEO157 encoding virulence gene and antibiotic resistance genes of E. coli strains isolated from mastitic milk samples (Table 1).

 

PCR amplification of 16srRNA encoding gene was performed according to Wang et al. (2002) as illustrated in Table 1. The reaction was performed in a volume of 25 μl containing 12.5 μl of 2X Qiagen Multiplex PCR Master Mix (Qiagen GmbH, Hilden, Germany), 0.5 µl (10pmol/µl) concentrations of each primer, and 3 μl of DNA template. The amplified PCR products were subjected to electrophoresis using 1.5% agarose gel.

 

 

Table 1: Oligonucleotide primers used for conventional PCR assay.

 

Target gene Primer sequence Amplicon size (bps) Source

Detection of E. coli isolates

16S rRNA

CCCCCTGGACGAAGACTGAC

ACCGCTGGCAACAAAGGATA

401

Wang et al. (2002)

β- lactamase genes

O157 (rfbEo157)

CGG ACA TCC ATG TGA TAT GG

TTG CCT ATG TAC AGC TAA TCC

259

Possé et al. (2007)

E. coli O157 gene

bla SHV

 

CTT TAT CGG CCC TCA CTC AA

AGG TGC TCA TCA TGG GAA AG

237

Fang et al. (2014)

bla TEM

 

CGC CGC ATA CAC TAT TCT CAG AAT GA

ACG CTC ACC GGC TCC AGA TTT AT

455

Monstein et al. (2007)

bla CTX-M

ATG TGC AGY ACC AGT AAR GTK ATG GC

TGG GTR AAR TAR GTS ACC AGA AYC AGC GG

593

Boyd et al. (2004)

bla OXA

 

ACA CAA TAC ATA TCA ACT TCG C

AGT GTG TTT AGA ATG GTG ATC

813

Ouelletteet al. (1987)

PABLs encoding gene
CMY II

AGCGATCCGGTCACGAAATA

CCCGTTTTATG CACCCATGA

695

Junyoung et al. (2009)

Colistin resistance encoding gene
mcr1

AGTCCGTTTGTTCTTGTGGC

AGATCCTTGGTCTCGGCTTG

320

Ana Rita Rebelo et al. (2018)


 

Esc Resistant E. Coli Isolates Identification

ESC E. coli isolates were determined by resistance to one or more third and fourth generation cephalosporins (CDC, 2020).

 

Antimicrobial Susceptibility Test

Antibiotic susceptibility test of E. coli isolates against nine different antibiotics was performed according to the Kirby-Bauer disc diffusion method using Mueller-Hinton agar (Bauer et al., 1966). The susceptibility of the E. coli isolates against each antimicrobial agent was measured and readings have been noted and compared with the Clinical and Laboratory Standards Institute guidelines (CLSI, 2020) (Table 2).

 

Table 2: Different antimicrobials used in disc diffusion method.

 

Antibiotic Concentration Abbreviation
Tetracycline

30 μg

TE
Cefoxitin

30 μg

CX/FOX
Cefotaxime

30 μg

CTX
Trimethoprim Sulfamethoxazole

1.25/23.75 μg

SXT
amoxycillin clavulanate

20/10 μg

AMC
Cefquinome

30 μg

CEQ
Cetazidime

30 μg

CAZ


RESULTS AND DISCUSSION

 

A high phenotypic prevalence (using EMB) of E. coli intramammary infection from mastitic dairy cows (68 out of 205) at the percent of 33%, where the genotypic prevalence (PCR to detect 16S rRNA gene) revealed 30.7% (63 out of 205) of dairy cows contract E. coli infection. The prevalence rate of bovine mastitis caused by E. coli was 33% of the overall milk samples. Most infections of the cows with E. coli are from their environment, as faces and straw as hypothesized by Lipman et al. (1995).

 

The proved 63 E. coli strains were then subjected for detection of E. coli O157 virulence gene, where only two STEC strains having rfbEO157 encoding gene had been detected using uniplex PCR at a percentage of 3.2% (Figure 1 & 2). Shiga toxin-producing E. coli (STEC) strains considered to be the most important pathogens of a recently emerged group of food-borne strains in the milk of infected cows. This type of strain has been associated with outbreaks of diarrhoea, gastroenteritis and hemorrhagic colitis (HC) or the hemolytic uremic syndrome (HUS) in humans (Karmali, 1989; Paton and Paton, 1998; Beutin et al., 2004). It is agreed with Hassan et al. (2012) who recorded that STEC strains can induce bovine mastitis and reduce milk quality for human consumption because some of the mastitis cases are subclinical and the diagnosis is based solely on accurate diagnostic tests.

 

 

 

Domestic ruminants, especially cattle, sheep and goats, are the principal reservoirs of STEC strains that cause human infections (Zschock et al., 2000; Chapman et al., 2001).

 

Regarding resistance genes, all of the isolates (100%) encoded TEM-type ESBLs, while none of which (0%) encoded OXA-type ESBLs. But, both CTX-M-type ESBLs and SHV-type β -lactamases were encoded in 53.9% (34 out of 63) and 4.7% (3 out of 63) of the ESBL isolates, respectively. Also, 27% exhibited CMYІІ-type PABLs. For plasmid-mediated colistin resistance encoding gene (mcr-1) was expressed in only one E. coli isolate at a percentage of 1.6% (1 out of 63). Regarding phenotypic non-β-lactams antimicrobial resistance, about 45.7% of E. coli isolates showed resistance to tetracycline, while 37.3% exhibited resistance to Trimethoprim-Sulfamethoxazole. This finding is similar to Sobhy et al. (2020) who associated higher resistance to Tetracyclines and Sulfamethoxazole/Trimethoprim with the prolonged use of these cheap antibiotics in the Egyptian dairy farms. In the same regard, Okubo et al. (2019) reported about 47.8% of bovine E. coli strains were co‐resistant to Ampicillin, Tetracycline and Sulfamethoxazole/Trimethoprim due to extensive use of these antimicrobials in Ugandan livestock.

 

Concerning molecular detection of the mcr-1 gene in ESC E. coli isolates were about 3%. This finding is in contrast to Umpiérrez et al. (2017) who recorded the absence of the mcr-1 gene in bovine E. coli strains, while Haenni et al. (2016) who detected an increase in the proportion of mcr-1 within ESBL-producing E. coli strains ranged from 4.76% in 2006 to 21.28% in 2014, prompting reducing colistin exposure.

 

 

 

21 E. coli isolates demonstrated phenotypic resistance to cefotaxime (CTX) and were encoding for the blaCTX gene. But, only 4 isolates showed phenotypic resistance although they lack blaCTX resistance gene (Table 3 & 4) & (Figure 3 & 4). The phenotypic resistance to ESCs antibiotics as (Cefotaxime, Cefquinome and Ceftazidime) was increased, due to their extensive and widespread use in veterinary medicine as mentioned by Ahmed and Shimamoto, (2015) when they declared that ESCs (3rd and 4th generation Cephalosporins) are necessary antibiotics used in vet

 

Table 3: Comparison between phenotypic and genotypic antimicrobial resistance pattern of E. coli isolates and their relation to O157 virulence gene.

 

Isolate code O157 Resistance phenotype ESBLs genes

Colistin resistance

mcr1

PABLs

blacmyІІ

Β-lactams

Non Β-lactams

CX CAZ CTX CEQ AMC SXT TE

blaTEM

blaCTX

blaSHV

blaOXA

2, 18       + +     + + +        
11, 57                 +         +
14 + + +           + +        
15     + + +       + +        
16       +         + +        
17       +

+

  +   + +        
20, 175, 177, 178                 + +       +
22, 50, 35       + +   + + + +        
23       +         +          
28, 41, 187, 204                 + +        
34, 46             +   + +        
42     + + +     + + +        
45     + +       + +   +      
48, 188       +

+

      + +        
81     + + +   + + + + +      
103, 104, 109, 111             + + +          
110, 202             + + +         +
130     + + + + + + + +        
148             +   +          
149, 150, 163   +

+

          +          
151   +         +   +          
155     +           +          
157           +   + +          
176     + + +   + +

+

        +
179         +       + +       +
181       +

+

    + + +       +
182         +     + + +       +
183         +       + +        
184                 +

+

      +
185       + +       + +       +
186     + + + +   + + +       +
189 + + + + +     + +

+

    + +
191     + + + + + + +          
192   + + + + + + + + +       +
194   + + + +       +          
195     + + + + + + + +       +
196   + + + + + + + + +        
198, 200               + +          
203                 +          

 

Table 4: Multidrug resistance pattern and resistance gene of E. coli isolates

 

Number of isolates Resistance phenotype

16s

RNA

O157 ESBLs genes

Colistin

(mcr1)

PABLs (blacmyІІ)

TEM CTX SHV OXA
17 SXT, CTX, CEQ + - + + - - - -
22, 50 SXT, TE, CTX, CEQ + - + + - - - -
35 SXT, TE, CTX, CEQ + - + + - - -

-

81 SXT, TE, CAZ, CTX, CEQ + - + + + - - -
14 CX, CAZ + + + + - - -

-

109, 111,104, 103, 77 SXT, TE + - + - - - - -
163, 150, 149 CX, CAZ + - + - - - - -
157 TE, AMC + - + - - - - -
151 SXT, CX + - + - - - - -
130 SXT, TE, AMC, CAZ, CTX, CEQ + - + + - - - -
110 SXT, TE + - + - - - - +
2, 18 TE, CTX, CEQ + - + + - - - -
42 TE, CAZ, CTX, CEQ + - + + - - -

-

45 TE, CAZ, CTX + - + - + - - -
15 CAZ, CTX, CEQ + - + + - - - -
48, 188 CTX, CEQ + - + + - - - -
181 TE, CTX, CEQ + - + + - - - +
182 TE, CEQ + - + + - - - +
185 CTX, CEQ + - + + - - - +
186 SXT, TE, CAZ, CTX, CEQ + - + + - - - +
189 TE, CX, CAZ, CTX, CEQ + + + + - - + +
195 SXT, TE + - + - - - -

-

 

Table 5: Extended spectrum and plasmid mediated ampicilin β-lactamases and colistin resistance genes of E. coli isolates from mastitic milk samples.

 

E. coli isolates

ESBLs PABLs no. Colistin no.

blaTEM

blaCTXM

blaSHV

blaOXA

blaCMYІІ

Mcr-1
No. 63 63 34 3 0 17 1
% - 100 54 4.7 0 27

1.6

 

erinary and human medicine.

 

The molecular detection of resistance genes such as ESBLs, PABLs and colistin resistance genes revealed that all E. coli isolates harbour blaTEM and about half of them bear blaCTXM, while 27% of the isolated have blaCMYІІ and only one isolate (1.6%) has Mcr-1 (Table 5) (Figure 3 & 4). Chirila et al. (2017) and Poirel et al. (2018) declared that E. coli may develop resistance to antimicrobials by chromosomal genes mutation or by horizontal gene transfer of resistance genes within commensal and pathogenic E. coli strains, rendering E. coli as a major reservoir of resistant genes that could be responsible for human and veterinary treatment failure.

 

There was a significant increase in isolates with resistance genes and exhibit ESC resistance as isolates carried blaTEM, blaTEM+ blaCTXM and blaTEM+ blaCTXM+ blaCMYІІ. In addition, ESC susceptible isolates also bear resistance genes such as blaTEM+, blaTEM+ blaCTXM+ blaCMYІІ, blaTEM+ blaCTXM and blaTEM+ blaCMYІІ (Table 6). ESC resistant E. coli strains were determined according to their resistance to one or more of

 

Table 6: ESC resistant and susceptible E. coli isolates and their antimicrobial resistance genes profile.

 

ESC resistance No. of isolates

blaTEM+

blaTEM+

blaTEM+& blaCTXM+

blaTEM+, blaCTXM+& blaCMYІІ+

blaCTXM

blaSHV

blaOXA

blaCMYІІ

Mcr-1

blaSHV

blaCMYІІ

Mcr-1
Resistant 33

15

(45.4%)

1

(3%)

-

1

(3%)

-

7

(21.2%)

1

(3%)

7

(21.2%)

1

(3%)

Susceptible 26

5

(19.2%)

1

(3.8%)

-

3

(11.5%)

-

12

(46%)

-

5

(19.2%)

-

 

Table 7: Antibiotic susceptibility profile of E. coli isolates

 

Antimicrobial agents Abbreviation

Conc.

(µg)

Susceptible Intermediate Resistance
No. % No. % No. %

Non β-lactams

Trimethoprim/Sulfamethoxazole SXT 1.25/23.75 38/59 64.4 0/59 0 22/59 37.3
Tetracycline TE 30 26/59 44.1 7/59 11.8 27/59 45.7

 

 

β-lactams

Cefoxitin CX 30 48/60 80 3/60 5 9/60 15
Amoxicillin/ clavulanate AMC 20/10 50/59 84.7 4/59 6.7 6/59 10.1
Ceftazidime CAZ 30 35/59 59.3 6/59 10.2 19/59 32.2
Cefotaxime CTX 30 32/59 54.2 3/59 5.1 25/59 42.3
Cefquinome CEQ 30 29/59 49.1 6/59 10.2 25/59

42.3

 


the 3rd and 4th generations of cephalosporins (CDC, 2020). In this line, the percentage of ESC resistant isolates was high 56% (33 out of 59). Based on ESCs resistance pattern and the presence of antimicrobial resistance genes, it was observed that the highest percentage of ESCs resistant E. coli isolates had blaTEM+ blaCTXM followed by blaTEM+ and blaTEM+ blaCTXM+ blaCMYІІ. Although ESC susceptible E. coli isolates possess β-lactamase resistance genes but were not expressed in vitro or phenotypically. It is agreed with Ahmed et al. (2009) when declared that E. coli strains showed phenotypic antibiotic multi-resistance primarily against ESCs, including Cefotaxime and Ceftriaxone, and other non-β-lactams; especially Tetracycline, Sulfamethoxazole/ Trimethoprim, Nalidixic acid and Ciprofloxacin.

 

With regard to E. coli isolates, about 45.4% of ESC resistant isolates were attributed to the presence of blaTEM and blaCTXM genes followed by blaTEM and blaTEM+ blaCTXM+ blaCMYІІ combinations at a rate of 21.2% for each. Almost all ESBLs producing isolates having blaTEM and two combinations including blaTEM + blaCTXM + blaCMYІІ and blaTEM + blaCTXM + blaCMYІІ + mcr1, which conferred resistance to Cefquinome as ESCs. It was contrary to Filioussis et al. (2020) who determined ESBLs producing strains from milk have blaTEM + blaSHV + mcr-1 and blaTEM + blaCTXM + mcr-1 combinations that conferred resistance to ESCs especially cefquinome.

 

Most ESC resistant E. coli isolates 26/33 (78.8%) have more than one antimicrobial resistance gene. This was agreed with Awosile et al. (2018) who determined the existence of two or more β-lactamase genes within 44% of ESC resistant strains, illustrating the phenotypic resistance of E. coli isolates is highly dependent on the co-existence of two or more β-lactamase genes in such isolates. The majority of ESC E. coli isolates 25/33 (75.7%) have β-lactamase CTX as reported by Livermore et al. (2007) and Seiffert et al. (2013) when it was noted that the worldwide evolution of β-lactamase CTX (Cefotaximase) has been identified and is known to be the most common cause of ESC resistance in the Enterobacteriaceae.

 

Concerning the antimicrobial susceptibility profile; Seven E. coli isolates (11.8%) were susceptible to all antimicrobials and only two isolates (3.4%) were resistant to all antimicrobials, eleven isolates (18.6%) expressed resistance to a single compound, and 36 isolates (61%) showed resistance to more than one antimicrobial agent. Whereas, twelve isolates (20.3%) were expressing resistance to 3 related compounds (i.e., Cefotaxime, Cefquinome and Ceftazidime) as extended spectrum cephalosporins (Table 7) & (Figure 5). Multidrug resistance (MDR) among E. coli isolates was high, where 61% of E. coli isolates (36/59) showed MDR against two or more antimicrobials, nine isolates (15.3%) exhibit MDR for β-lactam antibiotics, six isolates (10.2%) for non-β-lactam antibiotics, 19 isolates (32.2%) were resistant to both (β-lactams and non-β-lactams) and two isolates (3.4%) showed resistance to all antimicrobial used in this study. Our results were compatible with Pasayo et al. (2019) who declared that frequent use of antibiotic treatment leading to the production of multi-resistant strains that pose a major public health threat. But not aligned with Ahmed et al. (2009) who stated that lower multi-antibiotic resistance has been found in E. coli strains are 10.4%.

 

 

CONCLUSION

 

The emergence of antimicrobial resistance in particular to the recently introduced antimicrobials such as 3rd and 4th generations of cephalosporins in E. coli strains attributed to antimicrobial misuse in dairy farms for bovine mastitis therapy. E. coli strains acquire antimicrobial resistance through plasmid-mediated transfer leading to a widespread of multidrug resistance to ESCs, β-lactams and non-β-lactams antibiotics that can induce treatment failure in dairy farms.

 

ACKNOWLEDGMENTS

 

The authors would like to thank Dr. Mohamed Ibrahim, farm managers, staff and all helped with this work.

 

CONFLICT OF INTEREST

 

There are no conflicts of interest in this report, according to both of the contributors.

 

AUTHOR CONTRIBUTIONS

 

Adel Abdel-Azim Fayed approved of and arranged the tests. Soliman Mohamed Soliman created the hypothesis, computed it, and analyzed the results. The experiment was carried out by Samah El-sayed Mahmoud, and the manuscript was written with input and help from all contributors. Adel Abdel-Azim Fayed and Samia Abd El-Hamid Ahmed created the model and nearly all of the technical data. All writers discussed the conclusions, offered critical input, assisted in the creation of the study, and collaborated on the final manuscript.

 

ETHICS STATEMENT

 

All research procedures were carried out in accordance with the Animal Ethics Committee of APRI, ARC, Egypt’s recommendations for the treatment and use of lab animals.

 

REFERENCES

 

  • Ahmed AM, Shimamoto T (2015). Molecular analysis of multidrug resistance in Shiga toxin-producing Escherichia coli O157: H7 isolated from meat and dairy products. Int. J. Food Microbiol. 193:68-73. https://doi.org/10.1016/j.ijfoodmicro.2014.10.014
  • Ahmed AM, Younis EE, Osman SA, Ishida Y, El-khodery SA, Shimamoto T (2009). Genetic analysis of antimicrobial resistance in Escherichia coli isolated from diarrheic neonatal calves. Vet. Microbiol. 136:397-402. https://doi.org/10.1016/j.vetmic.2008.11.021
  • Awsile B, McClure J, Sanchez J, Rodriguez-Lecompte JC, Keefe G, Heider LC (2018). Salmonella enterica and extended spectrum cephalosporin-resistant Escherichia coli recovered from Holstein dairy calves from 8 farms in New Brunswiek, Canada. J. Dairy Sci. 101:3271-3284. https://doi.org/10.3168/jds.2017-13277
  • Barkema HW, Schukken YH, Lam TJGM, Beiboer ML, Benedictus G, Brand A (1999). Management practices associated with the incidence rate of clinical mastitis. J. Dairy Sci. 82:1643–1654. https://doi.org/10.3168/jds.S0022-0302(99)75393-2
  • Bauer A W, Kirby WM, Sherris JC et al (1966). Antibiotic susceptibility testing by a standardized single disc method. Am. J. Clin. Pathol. 45:493-496. https://doi.org/10.1093/ajcp/45.4_ts.493
  • Bengtsson B, Unnerstad HE, Ekman T, Artursson K, Nilsson-Ost M, Waller KP (2009). Antimicrobial susceptibility of udder pathogens from cases of acute clinical mastitis in dairy cows. Vet. Microbiol.136:142–9. https://doi.org/10.1016/j.vetmic.2008.10.024
  • Beutin L, Krause G, Zimmermann S, Kaulfuss S, Gleier K (2004). Characterization of Shiga toxin-producing Escherichia coli strains isolated from human patients in Germany over a 3-year period. J. Clin. Microbiol. 42:1099-1108.
  • Bradley AJ, Leach KA, Breen JE, Green LE, Green MJ (2007). Survey of the incidence and aetiology of mastitis on dairy farms in England and Wales. Vet. Rec. 160:253–7. https://doi.org/10.1136/vr.160.8.253
  • Cantas L, Shah SQA, Cavaco LM, Manaia CM, Walsh F, Popowska M, Garelick H, Bürgmann H, Sørum H (2013). A brief multi-disciplinary review on antimicrobial resistance in medicine and its linkage to the global environmental microbiota. Front. Microbiol. 4: 96. https://doi.org/10.3389/ fmicb.2013.00096.
  • Carattoli A. (2008). Animal reservoirs for extended spectrum βlactamase producers. Clin. Microbiol. Infect. 14:117-123 https://doi.org/10.1111/j.1469-0691.2007.01851.x.
  • CDC (2020). Antimicrobial use and resistance (AUR) module. Centers for Disease Control and Prevention, Atlanta, GA: http://www. cdc. gov/nhsn/PDFs/pscManual/11pscAURcurrent. pdf.
  • Chapman PA, Cerdan-Malo T, Ellin M, Ashton R, Harkin MA (2001). Escherichia coli O157 in cattle and sheep at slaughter, on beef and lamb carcasses, and in raw beef and lamb products in South Yorkshire, UK. Int. J. Food. Microbiol. 64:139-150. https://doi.org/10.1016/S0168-1605(00)00453-0
  • Chirila F, Tabaran A, Fit N, Nadas G, Mihaiu M, Tabaran F, Cătoi C, Reget OL, Dan SD (2017). Concerning increase in antimicrobial resistance in Shiga toxin-producing Escherichia coli isolated from young animals during 1980–2016. Microbes Environ. 32:252-259. https://doi.org/10.1264/jsme2.ME17023
  • CLSI (2020). Performance standards for antimicrobial susceptibility testing. 30th edition. CLSI supplement M100. Clinical and Laboratory Standards Institute, Wayne, PA.
  • David RC (2011). Staining and Interpretation of Smears. Laboratory Studies in Applied Microbiology. Rice University, USA. pp. 74-78.
  • De Vliegher S, Fox LK, Piepers S, McDougall S, Barkema HW (2012). Mastitis in dairy heifers: Nature of the disease, potential impact, prevention, and control. J. Dairy Sci. 95(3): 1025-1040. https://doi.org/10.3168/jds.2010-4074
  • Dufour S, Frechette A, Barkema HW, Mussell A, Scholl DT (2011). Invited review: Effect of udder health management practices on herd somatic cell count. J. Dairy Sci. 94:563–579. http://dx.doi. org/10.3168/jds.2010-3715
  • Elbably MA, Emeash HH, Asmaa NM (2013). Risk Factors Associated with Mastitis Occurrence in Dairy Herds in Benisuef, Egypt. World’s Vet. J. 3(1): 05-10. https://doi.org/10.5455/wvj.20130223
  • Filioussis G, Kachrimanidou M, Christodoulopoulos G, Kyritsi M, Hadjichristodoulou C, Adamopoulou M, Grinberg A (2020). Bovine mastitis caused by multidrug-resistant Escherichia coli clone on a greek dairy farm. J. Dairy Sci. 103: 852-857. https://doi.org/10.3168/jds.2019-17320
  • Grave T, Greko C et al. (1999). The usage of veterinary antibacterial drugs for mastitis in cattle in Norway and Sweden during 1990-1997. Prev. Vet. Med. 42:45-55. https://doi.org/10.1016/S0167-5877(99)00057-4
  • Haenni M, Métayer V, Gay E, Madec JY (2016). Increasing trends in mcr-1 prevalence among extended spectrum β-lactamase producing Escherichia coli isolates from French calves despite decreasing exposure to colistin. Antimicrob. Agent. Chemotherap. 60:6433-6434. https://doi.org/10.1128/AAC.01147-16
  • Hassan Momtaz, Farhad Safarpoor Dehkordi, Taghi Taktaz, Amir Rezvani, Sajad Yarali (2012). Shiga Toxin-Producing Escherichia coli Isolated from Bovine Mastitic Milk: Serogroups, Virulence Factors, and Antibiotic Resistance Properties. ScientificWorld J. vol., no. 618709: 1-9. https://doi.org/10.1100/2012/618709
  • Jacoby GA (2009). AmpC β-Lactamases. Clin. Microbiol. Rev. 22:161-182. https://doi.org/10.1128/CMR.00036-08
  • Kang SJ, Ryu SJ, Chae JS, et al. (2004). Occurrence and characteristics of enterohemorrhagic Escherichia coli O157 in calves associated with diarrhea. Vet. Microbiol. 98: 323-328. https://doi.org/10.1016/j.vetmic.2003.11.004
  • Karmali MA (1989). Infection by verocytotoxin-producing Escherichia coli .Clin. Microbiol. Rev. 2:15-38. https://doi.org/10.1128/CMR.2.1.15
  • Keane OM, Budd KE, Flynn J, McCoy F(2013). Pathogen profile of clinical mastitis in Irish milk-recording herds reveals a complex aetiology. Vet. Rec. 173:17. https://doi.org/10.1136/vr.101308
  • Kempf I, Fleury MA, Drider D, Bruneau M, Sanders P, Chauvin C, Madec JY Jouy E (2013). What do we know about resistance to colistin in Enterobacteriaceae in avian and pig production in Europe? Int. J. Antimicrob. Agent. 42:379-383. https://doi.org/10.1016/j.ijantimicag.2013.06.012
  • Levison LJ, Miller-Cushon EK, Tucker AL, Bergeron R, Leslie KE, HW Barkema HW, DeVries TJ (2016). Incidence rate of pathogen-specific clinical mastitis on conventional and organic Canadian dairy farms. J. Dairy Sci. 99:1341–1350. http://dx.doi.org/10.3168/jds.2015-9809
  • Lin A, Nguyen L, Lee T, Clotilde LM, Kase JA, Son I, Carter JM, Lauzon CR (2011). Rapid O serogroup identification of the ten most clinically relevant STECs by Luminex microbead-based suspension array. J. Microbiol. Methods. 87(1):105–110. https://doi.org/10.1016/j.mimet.2011.07.019
  • Lipman LJA, de Nijs A, Lam TJGM, Gaastra W (1995). Identification of Escherichia coli strains from cows with clinical mastitis by serotyping and DNA polymorphism patterns with REP and ERIC primers. Vet. Microbiol. 43:13-19. https://doi.org/10.1016/0378-1135(94)00070-D
  • Liu YY, Wang Y, Walsh TR, Yi LX, Zhang R, Spencer J, Doi Y, Tian G, Dong B, Huang X, Yu LF, Gu D, Ren H, Chen X, Lv L, He D, Zhou H, Liang Z, Shen J (2016). Emergence of plasmid mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect. Dis. 16:161-168. https://doi.org/10.1016/S1473-3099(15)00424-7
  • Livermore DM, Canton R, Gniadkowski M, Nordmann P, Rossolini GM, Arlet G, Ayala J, Coque TM, Kern-Zdanowicz I, Luzzaro F, Poirel L, Woodford N (2007). CTX-M: Changing the face of ESBLs in Europe. J. Antimicrob. Chemotherap. 59:165-174. https://doi.org/10.1093/jac/dkl483
  • Livermore DM, Woodford N (2006). The β-lactamase threat in Enterobacteriaceae, Pseudomonas and Acinetobacter. Trends Microbiol. 14:413-420. https://doi.org/10.1016/j.tim.2006.07.008
  • Mathew AG, Cissell R, Liamthong S (2007). Antibiotic resistance in bacteria associated with food animals: a United States perspective of livestock production. Foodborne Pathog. Dis. 4:115–33. https://doi.org/10.1089/fpd.2006.0066
  • McEwen SA, Fedorka-Cray PJ (2002). Antimicrobial use and resistance in animals. Clin. Infect. Dis. 34(Suppl 3):S93–S106. https://doi.org/10.1086/340246
  • Naderi Z, Ghanbarpour R and Sami M (2016). Antimicrobial resistance characteristics and phylogenetic groups of Escherichia coli isolated from diarrheic calves in southeast of Iran. Int. J. Enteric Pathog. 4:1-7.
  • National Mastitis Council (NMC) (1990). Microbiological procedures for the diagnosis of udder infection. 3rd ed. Arlington, VA: National Mastitis Council Inc. https://doi.org/10.15171/ijep.2016.15
  • Okubo T, Yossapol M, Maruyama F, Wampande EM, Kakooza S, Ohya K, Tsuchida S, Asai T, Kabasa JD, Ushida K (2019). Phenotypic and genotypic analyses of antimicrobial resistant bacteria in livestock in Uganda. Transbound. Emerg. Dis. 66:317-326. https://doi.org/10.1111/tbed.13024
  • Olde Riekerink RG, Barkema HW, Kelton DF, Scholl DT (2008). Incidence rate of clinical mastitis on Canadian dairy farms. J. Dairy Sci. 91:1366–77. https://doi.org/10.3168/jds.2007-0757
  • Pasayo RAG, Sanz ME, Padola NL, Moreira AR (2019). Phenotypic and genotypic characterization of enterotoxigenic Escherichia coli isolated from diarrheic calves in Argentina. Open Vet. J. 9:65-73. https://doi.org/10.4314/ovj.v9i1.12
  • Paton JC, Paton AW (1998). Pathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infection. Clin. Microbiol. Rev. 11:450- 479. https://doi.org/10.1128/CMR.11.3.450
  • Piepers S, Peeters K, Opsomer G, Barkema HW, Frankena K, De Vliegher S (2011). Pathogen group specific risk factors at herd, heifer and quarter levels for intramammary infections in early lactating dairy heifers. Prev. Vet. Med. 99:91–101. http://dx.doi.org/10.1016/j.prevetmed.2011.02.010
  • Poirel L, Jayol A, Nordmann P (2017). Polymyxins: antibacterial activity, susceptibility testing, and resistance mechanisms encoded by plasmids or chromosomes. Clin. Microbiol. Rev. 30:557-596. https://doi.org/10.1128/CMR.00064-16
  • Poirel L, Madec JY, Lupo A, Schink AK, Kieffer N, Nordmann P, Schwarz S (2018). Antimicrobial resistance in Escherichia coli, in: Schwarz S, Shen J and Cavaco L (editors), Antimicrobial Resistance in Bacteria from Livestock and Companion Animals, American Society for Microbiology, Washington, PP:289-316. https://doi.org/10.1128/microbiolspec.ARBA-0026-2017
  • Pyörälä S (2009). Treatment of mastitis during lactation. University of Helsinki, Faculty of Veterinary Medicine, Department of Production Animal Medicine, Pohjoinen Pikatie. Irish Vet. J. (62): 40-44. https://doi.org/10.1186/2046-0481-62-S4-S40
  • Rebelo AR, Bortolaia V, Kjeldgaard JS, Pedersen SK, Leekitcharoenphon P, Hansen IM, Guerra B, Malorny B, Borowiak, M, Hammerl JA, Battisti A, Franco A, Alba P, Perrin-Guyomard A, Granier SA, Escobar CD, Malhotra-Kumar S, Villa L, Carattoli A, Hendriksen RS (2018). Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. Eurosurv. 23:17-00672. https://doi.org/10.2807/1560-7917.ES.2018.23.6.17-00672
  • Seiffert SN, Hilty M, Perreten V, Endimiani A (2013). Extended- spectrum cephalosporin-resistant gram-negative organisms in livestock: An emerging problem for human health? Drug Resistance Updates. 16:22-45. https://doi.org/10.1016/j.drup.2012.12.001
  • Sobhy NM, Yousef SG, Aboubakr HA, Nisar M, Nagaraja KV, Mor SK, Valeris-Chacin RJ, Goyal SM (2020). Virulence factors and antibiograms of Escherichia coli isolated from diarrheic calves of Egyptian cattle and water buffaloes. Plos One. 15:e0232890. https://doi.org/10.1371/journal.pone.0232890
  • Suojala L, Kaartinen L, Pyorala S (2013). Treatment for bovine Escherichia coli mastitis—an evidence-based approach. J. Vet. Pharmacol. Ther. 36:521–31. https://doi.org/10.1111/jvp.12057
  • Sweeney MT, Lubbers BV, Schwarz S, Watts JL (2018). Applying definitions for multidrug resistance, extensive drug resistance and pandrug resistance to clinically significant livestock and companion animal bacterial pathogens. J. Antimicrob. Chemother. 73:1460–3. https://doi.org/10.1093/jac/dky043
  • Trevisi E, Zecconi A, Cogrossi S, Razzuoli E, Grossi P, Amadori M (2014) Strategies for reduced antibiotic usage in dairy cattle farms. Res. Vet. Sci., 96: 229-233. https://doi.org/10.1016/j.rvsc.2014.01.001
  • Umpiérrez A, Bado I, Oliver M, Acquistapace S, Etcheverría A, Padola NL, Vignoli R, Zunino P (2017). Zoonotic potential and antibiotic resistance of Escherichia coli in Neonatal calves in Uruguay. Microbes Environ. 32:275-282. https://doi.org/10.1264/jsme2.ME17046
  • Walther B, Tedin K, Lübke-Becker A (2017). Multidrug-resistant opportunistic pathogens challenging veterinary infection control. Vet. Microbiol. 200: 71-78. https://doi.org/10.1016/j. Vetmic. 2016.05.017.
  • Wang G, Clark CG and Rodgers FG, 2002. Detection in Escherichia coli of the genes encoding the major virulence factors, the genes defining the O157: H7 serotype, and components of the type 2 Shiga toxin family by multiplex PCR. J. Clin. Microbiol. 40: 3613-3619. https://doi.org/10.1128/JCM.40.10.3613-3619.2002.
  • Wenz JR, Barrington GM, Garry FB, Dinamore RP, Callan RJ (2001). Use of systemic disease signs to assess disease severity in dairy cows with acute coliform mastitis. J. Am. Vet. Med. Assoc. 218:567-572. https://doi.org/10.2460/javma.2001.218.567
  • Zschock M, Hamann HP, Kloppert B and Wolter W (2000). Shiga-toxinproducing Escherichia coli in faeces of healthy dairy cows, sheep and goats: prevalence and virulence properties. Lett. Appl. Microbiol. 31:203-208. https://doi.org/10.1046/j.1365-2672.2000.00789.x
  •